ortopeda dziecięcy oleśnica

Zaszyfrowano siRNA GRAF, GAPDH, SOX9 i PTHLH (Ambion). Otrzymano różne skonstruowane na zamówienie siRNA dla lncRNA. Dla uproszczenia wizualnego przedstawiono wyniki z użyciem tylko siRNA. SiRNA DA125942 były następujące: sens siRNA-1, GCACAUGACCACAUGGAAATT; siRNA-1 antysens, UUUCCAUGUGGUCAUGUGCGA; sens siRNA-2, GUUUCULUCAGCAAAUUCATT; antysensowny siRNA-2, UGAAUUUGCUGAGAGAAACTG; sens siRNA-3, CAAGGACACUGAAAAAGCUTT; antysensowny siRNA-3, AGCUUUUUCAGUGUCCUUGAG. SiRNA AW491522 były następujące: sens siRNA-1, AGGCCCUGAUGCUAGUGAATT; antysensowny siRNA-1, UUCACUAGCAUCAGGGCCUTG; sens siRNA-2, GCACGCAUCUCUUCCACCATT; antysensowny siRNA-2, UGGUAAGAGAUGCGUGCGG. SiRNA BM385392 były następujące: sens siRNA-1, GAGAUCUGGGAGAGCAAATT; antysensowny siRNA-1, UUUGCUCUGACCAGAUCUCTA; sens siRNA-2, CAAUACUUCUCGACUCUCUTT; antysensowny siRNA-2, AGAGAGUCCAGAAGUAUUGCA. Kontrolą ujemną był szyfrowany siRNA. SOX9, DA125942 i PTHLH były znacząco obniżone (> 75%). SiRNA dla GAPDH stanowiło odniesienie do wydajności transfekcji i regulacji w dół. Transfekcje nadekspresyjne przeprowadzono jak opisano wcześniej przez Fugene X-tremeGENE HP (Roche). Plazmidy ekspresyjne PTHLH (SC307833) i SOX9 (SC321884) otrzymano z OriGene. Bioinformatyka i 3. analiza macierzy ekspresji. Sekwencje genomowe analizowano za pomocą NCBI BLAST, UCSC BLAT, powtórzenie maskowania w Instytucie GIRI oraz w Przeglądarce Genomu UCSC (marzec 2006; NCBI36 / hg18) (70, 71). Wersje 2.0 i Transfac Professional wersja 10.2 zostały użyte do określenia TFBSs zakonserwowanych przez ssaki (72, 73). Funkcjonalne eksperymenty przeprowadzono co najmniej 3 razy. Liczba eksperymentów (n) jest przedstawiona w legendach figur. Istotność została określona za pomocą testu ucznia. Wykrywanie sygnałów w kolokalizacji – FISH poddano analizie statystycznej za pomocą testu sumy rangowej Manna-Whitneya; dane reprezentują średnią. SD. Profilowanie ekspresji przeprowadzono na tablicach ht12 (Illumina) w potrójnych testach biologicznych, następnie ANOVA, testy wielokrotne (FDR 5%), klaster, wzbogacenie GProfiler i analiza STRING. Zbiór danych mikromacierzy został zdeponowany w GEO (nr dostępu GSE39896; http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi.acc=GSE39896). W macierzy platformy BeadStudio 1.0.2.20706 dane zostały znormalizowane kwantylem na poziomie sondy bez korekcji tła, a konsekwentnie transkrypty o niskiej ekspresji (minimalna detekcja P> 0,05) zostały odrzucone. Dane przekształcono w log2 po dodaniu przesunięcia (16) i analizowano pod kątem istotnych różnic w ekspresji między 4 grupami (zubożone siRNA i poddane nadmiernej ekspresji RNA DA125942 C28 / I2, kontrole z pustym wektorem ekspresyjnym i wymieszanym siRNA) w trzech powtórzeniach, stosując ANOVA, a następnie FDR (74) korekta wielokrotnego testowania. Sondy, które przeszły 5% FDR były k skupione przy średniej funkcji odległości euklidesowej i k = 5, zgodnie z lokalnym minimum w oszacowaniu Davies-Bouldin k (75). Klastry 1, 2 i 4 wybrano zgodnie z tymi wybitnymi stanami ekspresji w wyciszaniu DA125942 i zbadano dalej przez wzbogacenie funkcjonalne i interakcję. Analiza wzbogacania została przeprowadzona przy użyciu G: Profiler (76), z opartym na symulacji analitycznym progiem dla oceny istotności. Fizyczne i funkcjonalne interakcje między białkami określano przy użyciu platformy String (77) i średniej ufności wynoszącej 0,4. Wynikowe single zostały odrzucone przed wizualizacją sieci. Myszy transgeniczne. Ludzki (chromosom 12; 52 430,503 5 523 992 bp, montaż hg18) i mysz (chromosom 15; 102,576,412 [102, 577,508 bp; montaż mm9). CISTR-ACT sklonowano w konstrukcie reporterowym Sfi-Hsp68LacZ (78). Zlinearyzowane DNA wyekstrahowane żelem wstrzyknięto w zapłodnione komórki jajowe myszy według standardowych procedur. W każdym punkcie czasowym analizowano 25. 42 zarodków za pomocą barwienia metodą lacZ w całości. Statystyka
[podobne: opokan ulotka, krioglobulinemia, evra ulotka ]